|
The miProfile human heart disease miRNA qPCR array profiles 84 aberrantly expressed miRNAs relevant to heart diseases that include cardiac hypertrophy, cardiovascular disease, coronary artery disease, heart failure, myocardial infarction and so on. More and
|
Buy from Supplier |
|
Danaher Inc
mirna 940 ggggagcgggggccctgcctt ![]() Mirna 940 Ggggagcgggggccctgcctt, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Human+Heart+miRNA/pmc04196658-41-8-18?v=Danaher+Inc Average 99 stars, based on 1 article reviews
mirna 940 ggggagcgggggccctgcctt - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Omega Bio Tek
e z n a mirna kit ![]() E Z N A Mirna Kit, supplied by Omega Bio Tek, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Human+Heart+miRNA/pmc07191129-282-31-34?v=Omega+Bio+Tek Average 95 stars, based on 1 article reviews
e z n a mirna kit - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp efemp2 hs00973815 m1 ![]() Gene Exp Efemp2 Hs00973815 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Human+Heart+miRNA/pmc12022050__42003_2025_8087_MOESM2_ESM-6-14--1?v=Thermo+Fisher Average 94 stars, based on 1 article reviews
gene exp efemp2 hs00973815 m1 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Janssen
ipscderived cardiomyocytes ![]() Ipscderived Cardiomyocytes, supplied by Janssen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Human+Heart+miRNA/pm38727253-430-41-19?v=Janssen Average 86 stars, based on 1 article reviews
ipscderived cardiomyocytes - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Journal of Cellular and Molecular Medicine
Article Title: miRNA-940 reduction contributes to human Tetralogy of Fallot development
doi: 10.1111/jcmm.12309
Figure Lengend Snippet: miRNA-940 is the most down-regulated miRNA in TOF patients. ( A ) Northern blot shows that miRNA-940 is highly expressed in human heart. Shown in each lane is: 1-lung; 2-pancrease; 3-heart; 4-brain; 5-kidney; 6-skeletal muscle; 7-spleen; 8-liver; 9-bladder; 10-stomach; 11-colon; 12-intesetin. U6 was used as a loading control. ( B ) qRT-PCRs validate the down-regulation of miRNA-940 in an independent set of 26 TOF patients comparing to 15 healthy controls. * P < 0.05.
Article Snippet: An end-labelled (Exiqon, Vedbaek, Denmark) oligonucleotide probe for
Techniques: Northern Blot
Journal: Journal of Cellular and Molecular Medicine
Article Title: miRNA-940 reduction contributes to human Tetralogy of Fallot development
doi: 10.1111/jcmm.12309
Figure Lengend Snippet: miRNA-940 is most abundant in human right ventricular out-flow tract. Expression profile of ( A ) miRNA-940; ( B ) miR-1; ( C ) miR-133a; ( D ) miR-133b; ( E ) miR-499-3p; ( F ) miR-499-5p; ( G ) miR-208a; ( H ) miR-208b in different part of human hearts. RA, right atria; LA, left atria; RV, right ventricle; LV, left ventricle; OTF, right ventricular out-flow tract. * P < 0.05, compared to RA, n = 6.
Article Snippet: An end-labelled (Exiqon, Vedbaek, Denmark) oligonucleotide probe for
Techniques: Expressing
Journal: Journal of Cellular and Molecular Medicine
Article Title: miRNA-940 reduction contributes to human Tetralogy of Fallot development
doi: 10.1111/jcmm.12309
Figure Lengend Snippet: Effects of miRNA-940 mimics and inhibitors on hCMPCs proliferation. Quantification of transfection of miRNA-940 inhibitor ( A ) and miRNA-940 mimics ( B ) in a serial concentrations from seven independent experiments. ( C ) Representative images of miRNA-940 modulation on hCMPCs proliferation as assessed by counting numbers of EdU incorporated cells (×200). ( D ) Quantification of the effects of miRNA-940 mimics and inhibitors on hCMPCs proliferation. * P < 0.05, compared to control, n = 8.
Article Snippet: An end-labelled (Exiqon, Vedbaek, Denmark) oligonucleotide probe for
Techniques: Transfection
Journal: Journal of Cellular and Molecular Medicine
Article Title: miRNA-940 reduction contributes to human Tetralogy of Fallot development
doi: 10.1111/jcmm.12309
Figure Lengend Snippet: Effects of miRNA-940 mimics and inhibitors on hCMPCs migration. ( A ) Representative images showing the effects of miRNA-940 on hCMPCs migration (×100). ( B ) Quantification of the effects of the miRNA-940 inhibitors on hCMPCs migration. * P < 0.05, compared to mock, n, mock = 7, n, mimics = 6, n, inhibitor = 5.
Article Snippet: An end-labelled (Exiqon, Vedbaek, Denmark) oligonucleotide probe for
Techniques: Migration
Journal: Journal of Cellular and Molecular Medicine
Article Title: miRNA-940 reduction contributes to human Tetralogy of Fallot development
doi: 10.1111/jcmm.12309
Figure Lengend Snippet: JARID2 is identified as a target gene of miRNA-940. Quantification of luciferase expression levels are shown for 6 independent experiments for JARID2 ( A ). * P < 0.05, compared to control. ( B ) Western-blot results and quantification of JARID2 protein level in hCMPCs after negative control, miRNA-940 inhibitor or miRNA-940 mimics transfection. * P < 0.05, compared to control for three independent experiments. ( C ) Western-blot results and quantification of JARID2 protein level in tissues from healthy individuals and TOF patients. Comparisons were between healthy individuals and TOF patients. * P < 0.05, for three independent experiments.
Article Snippet: An end-labelled (Exiqon, Vedbaek, Denmark) oligonucleotide probe for
Techniques: Luciferase, Expressing, Western Blot, Negative Control, Transfection
Journal: Journal of Cellular and Molecular Medicine
Article Title: miRNA-940 reduction contributes to human Tetralogy of Fallot development
doi: 10.1111/jcmm.12309
Figure Lengend Snippet: Quantification of the effect on proliferation of JARID2 siRNA trasnsfection in the miRNA-940 inhibitor transfected hCMPCs. * # P < 0.05, for five independent experiments.
Article Snippet: An end-labelled (Exiqon, Vedbaek, Denmark) oligonucleotide probe for
Techniques: Transfection